Welcome to Introduction to Bioinformatics Wednesday, 25 January Introduction to Molecular Biology

All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
 20 views
of 59

Please download to get full document.

View again

Description
Welcome to Introduction to Bioinformatics Wednesday, 25 January Introduction to Molecular Biology Part 2: DNA to protein. Coming attractions! Significance Palindromes (SQ4) Why introns? (SQ8) Types of mutation (SQ12).
Share
Transcript
Welcome toIntroduction to BioinformaticsWednesday, 25 JanuaryIntroduction to Molecular Biology Part 2: DNA to protein
  • Coming attractions!
  • Significance
  • Palindromes (SQ4)
  • Why introns? (SQ8)
  • Types of mutation (SQ12)
  • I think the Blackboard discussions can be really helpful with using peers as resources These discussion groups may be useful if they are utilized by others in the class. i am pretty certain it will if people actively read and use it. little understanding of what the big picture is. with using peers as resources when explaining the concepts please also mention the practical applications 2008 with using peers as resources 1993 2012 Escherichia coli . . . with using peers as resources . . . very small lab rats Courtesy of Kent State University Microbiology E. coli: What makes it kill? E. coli with using peers as resources : What makes it kill? Escherichia coli . . . haemorrhagic colitis TCTACTTATA TTCAATCCAC AGGGCTACAC with using peers as resources AAGAGTCTGT TGAATGAACA CATACATGGT TTCTGTCTGC TCTGACCTCT GGCAGCTTTC TGGATTTCGG AACTCTAGCC TGCCCCACTC GAACCTTAGT GACTTCTGCT ATACCAAAGT CTCCGTAAAC CTCTAACATG ATGTCAGCAA TGAATAAACT TTGTTAAAGG TACAAATGAA AAGAGTTTAA AGTTAAAAAC GAATTGCAGT AAACCTGTAT GGTTACATGA ACTGCCTAAA TTATATATTT TAAGAAATTA ATTGCAATTA CCCCAGCTGT CATTAAAAAG AGGCAAATAC GACAGCACTG ACCCTCAAGA AGGCACCGGC GCTGAAATTC CGCTGAGAGC AGAGTGGTAC CCCTGCACCA GGTCTTTCCT GTGGGCACTG ATGAATGACT GAACGAACGA TTGAATGAAA TCTACTTATA TTCAATCCAC AGGGCTACAC AAGAGTCTGT TGAATGAACA CATACATGGT TTCTGTCTGC TCTGACCTCT GGCAGCTTTC TGGATTTCGG AACTCTAGCC TGCCCCACTC GAACCTTAGT GACTTCTGCT ATACCAAAGT CTCCGTAAAC CTCTAACATG ATGTCAGCAA TGAATAAACT TTGTTAAAGG TACAAATGAA AAGAGTTTAA AGTTAAAAAC GAATTGCAGT AAACCTGTAT GGTTACATGA ACTGCCTAAA TTATATATTT TAAGAAATTA ATTGCAATTA CCCCAGCTGT CATTAAAAAG AGGCAAATAC GACAGCACTG ACCCTCAAGA AGGCACCGGC GCTGAAATTC CGCTGAGAGC AGAGTGGTAC CCCTGCACCA GGTCTTTCCT GTGGGCACTG ATGAATGACT GAACGAACGA TTGAATGAAA Gene finder Gene finder E. coli: What makes it kill? E. coli K12 E. coli O157:H7 TCTACTTATA TTCAATCCAC AGGGCTACAC with using peers as resources AAGAGTCTGT TGAATGAACA CATACATGGT TTCTGTCTGC TCTGACCTCT GGCAGCTTTC TGGATTTCGG AACTCTAGCC TGCCCCACTC GAACCTTAGT GACTTCTGCT ATACCAAAGT CTCCGTAAAC CTCTAACATG ATGTCAGCAA TGAATAAACT TTGTTAAAGG TACAAATGAA AAGAGTTTAA AGTTAAAAAC GAATTGCAGT AAACCTGTAT GGTTACATGA ACTGCCTAAA TTATATATTT TAAGAAATTA ATTGCAATTA CCCCAGCTGT CATTAAAAAG AGGCAAATAC GACAGCACTG ACCCTCAAGA AGGCACCGGC GCTGAAATTC CGCTGAGAGC AGAGTGGTAC CCCTGCACCA GGTCTTTCCT GTGGGCACTG ATGAATGACT GAACGAACGA TTGAATGAAA TCTACTTATA TTCAATCCAC AGGGCTACAC AAGAGTCTGT TGAATGAACA CATACATGGT TTCTGTCTGC TCTGACCTCT GGCAGCTTTC TGGATTTCGG AACTCTAGCC TGCCCCACTC GAACCTTAGT GACTTCTGCT ATACCAAAGT CTCCGTAAAC CTCTAACATG ATGTCAGCAA TGAATAAACT TTGTTAAAGG TACAAATGAA AAGAGTTTAA AGTTAAAAAC GAATTGCAGT AAACCTGTAT GGTTACATGA ACTGCCTAAA TTATATATTT TAAGAAATTA ATTGCAATTA CCCCAGCTGT CATTAAAAAG AGGCAAATAC GACAGCACTG ACCCTCAAGA AGGCACCGGC GCTGAAATTC CGCTGAGAGC AGAGTGGTAC CCCTGCACCA GGTCTTTCCT GTGGGCACTG ATGAATGACT GAACGAACGA TTGAATGAAA Gene finder Gene finder E. coli: What makes it kill? E. coli K12 E. coli O157:H7 Killer protein with using peers as resources Killer functions Membrane protein, sodium transporter Iron responsive transcriptional regulator Calcium dependent protein kinase Unknown protein Unknown protein Unknown protein . . . Similarity finder ideas for new antibiotics E. coli: What makes it kill? How to find set of O157:H7-specific protein? TCTACTTATA TTCAATCCAC AGGGCTACAC with using peers as resources AAGAGTCTGT TGAATGAACA CATACATGGT TTCTGTCTGC TCTGACCTCT GGCAGCTTTC TGGATTTCGG AACTCTAGCC TGCCCCACTC GAACCTTAGT GACTTCTGCT ATACCAAAGT CTCCGTAAAC CTCTAACATG ATGTCAGCAA TGAATAAACT TTGTTAAAGG TACAAATGAA AAGAGTTTAA AGTTAAAAAC GAATTGCAGT AAACCTGTAT GGTTACATGA ACTGCCTAAA TTATATATTT TAAGAAATTA ATTGCAATTA CCCCAGCTGT CATTAAAAAG AGGCAAATAC GACAGCACTG ACCCTCAAGA AGGCACCGGC GCTGAAATTC CGCTGAGAGC AGAGTGGTAC CCCTGCACCA GGTCTTTCCT GTGGGCACTG ATGAATGACT GAACGAACGA TTGAATGAAA TCTACTTATA TTCAATCCAC AGGGCTACAC AAGAGTCTGT TGAATGAACA CATACATGGT TTCTGTCTGC TCTGACCTCT GGCAGCTTTC TGGATTTCGG AACTCTAGCC TGCCCCACTC GAACCTTAGT GACTTCTGCT ATACCAAAGT CTCCGTAAAC CTCTAACATG ATGTCAGCAA TGAATAAACT TTGTTAAAGG TACAAATGAA AAGAGTTTAA AGTTAAAAAC GAATTGCAGT AAACCTGTAT GGTTACATGA ACTGCCTAAA TTATATATTT TAAGAAATTA ATTGCAATTA CCCCAGCTGT CATTAAAAAG AGGCAAATAC GACAGCACTG ACCCTCAAGA AGGCACCGGC GCTGAAATTC CGCTGAGAGC AGAGTGGTAC CCCTGCACCA GGTCTTTCCT GTGGGCACTG ATGAATGACT GAACGAACGA TTGAATGAAA Gene finder Gene finder How to find set of O157:H7-specific protein? E. coli K12 E. coli O157:H7 How to sift through thousands of proteins? TCTACTTATA TTCAATCCAC AGGGCTACAC with using peers as resources AAGAGTCTGT TGAATGAACA CATACATGGT TTCTGTCTGC TCTGACCTCT GGCAGCTTTC TGGATTTCGG AACTCTAGCC TGCCCCACTC GAACCTTAGT GACTTCTGCT ATACCAAAGT CTCCGTAAAC CTCTAACATG ATGTCAGCAA TGAATAAACT TTGTTAAAGG TACAAATGAA AAGAGTTTAA AGTTAAAAAC GAATTGCAGT AAACCTGTAT GGTTACATGA ACTGCCTAAA TTATATATTT TAAGAAATTA ATTGCAATTA CCCCAGCTGT CATTAAAAAG AGGCAAATAC GACAGCACTG ACCCTCAAGA AGGCACCGGC GCTGAAATTC CGCTGAGAGC AGAGTGGTAC CCCTGCACCA GGTCTTTCCT GTGGGCACTG ATGAATGACT GAACGAACGA TTGAATGAAA TCTACTTATA TTCAATCCAC AGGGCTACAC AAGAGTCTGT TGAATGAACA CATACATGGT TTCTGTCTGC TCTGACCTCT GGCAGCTTTC TGGATTTCGG AACTCTAGCC TGCCCCACTC GAACCTTAGT GACTTCTGCT ATACCAAAGT CTCCGTAAAC CTCTAACATG ATGTCAGCAA TGAATAAACT TTGTTAAAGG TACAAATGAA AAGAGTTTAA AGTTAAAAAC GAATTGCAGT AAACCTGTAT GGTTACATGA ACTGCCTAAA TTATATATTT TAAGAAATTA ATTGCAATTA CCCCAGCTGT CATTAAAAAG AGGCAAATAC GACAGCACTG ACCCTCAAGA AGGCACCGGC GCTGAAATTC CGCTGAGAGC AGAGTGGTAC CCCTGCACCA GGTCTTTCCT GTGGGCACTG ATGAATGACT GAACGAACGA TTGAATGAAA Gene finder Gene finder How to find set of O157:H7-specific protein? E. coli K12 E. coli O157:H7 How to sift through thousands of proteins? TCTACTTATA TTCAATCCAC AGGGCTACAC with using peers as resources AAGAGTCTGT TGAATGAACA CATACATGGT TTCTGTCTGC TCTGACCTCT GGCAGCTTTC TGGATTTCGG AACTCTAGCC TGCCCCACTC GAACCTTAGT GACTTCTGCT ATACCAAAGT CTCCGTAAAC CTCTAACATG ATGTCAGCAA TGAATAAACT TTGTTAAAGG TACAAATGAA AAGAGTTTAA AGTTAAAAAC GAATTGCAGT AAACCTGTAT GGTTACATGA ACTGCCTAAA TTATATATTT TAAGAAATTA ATTGCAATTA CCCCAGCTGT CATTAAAAAG AGGCAAATAC GACAGCACTG ACCCTCAAGA AGGCACCGGC GCTGAAATTC CGCTGAGAGC AGAGTGGTAC CCCTGCACCA GGTCTTTCCT GTGGGCACTG ATGAATGACT GAACGAACGA TTGAATGAAA TCTACTTATA TTCAATCCAC AGGGCTACAC AAGAGTCTGT TGAATGAACA CATACATGGT TTCTGTCTGC TCTGACCTCT GGCAGCTTTC TGGATTTCGG AACTCTAGCC TGCCCCACTC GAACCTTAGT GACTTCTGCT ATACCAAAGT CTCCGTAAAC CTCTAACATG ATGTCAGCAA TGAATAAACT TTGTTAAAGG TACAAATGAA AAGAGTTTAA AGTTAAAAAC GAATTGCAGT AAACCTGTAT GGTTACATGA ACTGCCTAAA TTATATATTT TAAGAAATTA ATTGCAATTA CCCCAGCTGT CATTAAAAAG AGGCAAATAC GACAGCACTG ACCCTCAAGA AGGCACCGGC GCTGAAATTC CGCTGAGAGC AGAGTGGTAC CCCTGCACCA GGTCTTTCCT GTGGGCACTG ATGAATGACT GAACGAACGA TTGAATGAAA Gene finder Gene finder How to find set of O157:H7-specific protein? E. coli K12 E. coli O157:H7 DEFINE K12-set AS Genes-ofK12-DNA DEFINE O157-set AS Genes-ofO157-DNA FOR EACH protein IN O157-set WHEN Constituent-of (K12-set, protein) = FALSE COLLECT protein "Constituent-of"? "Same"? How to find basis of drought resistance? with using peers as resources Wild-type crops Drought-resistant Gene finder Gene finder Ray Wu, Cornell Univ. DEFINE K12-set AS Genes-ofK12-DNA DEFINE O157-set AS Genes-ofO157-DNA FOR EACH protein IN O157-set WHEN Constituent-of (K12-set, protein) = FALSE COLLECT protein "Constituent-of"? "Same"? How to find basis of human traits? with using peers as resources Great apes Humans Gene finder Gene finder DEFINE K12-set AS Genes-ofK12-DNA DEFINE O157-set AS Genes-ofO157-DNA FOR EACH protein IN O157-set WHEN Constituent-of (K12-set, protein) = FALSE COLLECT protein "Constituent-of"? "Same"? TCTACTTATA TTCAATCCAC AGGGCTACAC with using peers as resources AAGAGTCTGT TGAATGAACA CATACATGGT TTCTGTCTGC TCTGACCTCT GGCAGCTTTC TGGATTTCGG AACTCTAGCC TGCCCCACTC GAACCTTAGT GACTTCTGCT ATACCAAAGT CTCCGTAAAC CTCTAACATG ATGTCAGCAA TGAATAAACT TTGTTAAAGG TACAAATGAA AAGAGTTTAA AGTTAAAAAC GAATTGCAGT AAACCTGTAT GGTTACATGA ACTGCCTAAA TTATATATTT TAAGAAATTA ATTGCAATTA CCCCAGCTGT CATTAAAAAG AGGCAAATAC GACAGCACTG ACCCTCAAGA AGGCACCGGC GCTGAAATTC CGCTGAGAGC AGAGTGGTAC CCCTGCACCA GGTCTTTCCT GTGGGCACTG ATGAATGACT GAACGAACGA TTGAATGAAA TCTACTTATA TTCAATCCAC AGGGCTACAC AAGAGTCTGT TGAATGAACA CATACATGGT TTCTGTCTGC TCTGACCTCT GGCAGCTTTC TGGATTTCGG AACTCTAGCC TGCCCCACTC GAACCTTAGT GACTTCTGCT ATACCAAAGT CTCCGTAAAC CTCTAACATG ATGTCAGCAA TGAATAAACT TTGTTAAAGG TACAAATGAA AAGAGTTTAA AGTTAAAAAC GAATTGCAGT AAACCTGTAT GGTTACATGA ACTGCCTAAA TTATATATTT TAAGAAATTA ATTGCAATTA CCCCAGCTGT CATTAAAAAG AGGCAAATAC GACAGCACTG ACCCTCAAGA AGGCACCGGC GCTGAAATTC CGCTGAGAGC AGAGTGGTAC CCCTGCACCA GGTCTTTCCT GTGGGCACTG ATGAATGACT GAACGAACGA TTGAATGAAA Gene finder Gene finder How to find set of O157:H7-specific protein? E. coli K12 E. coli O157:H7 DEFINE K12-set AS Genes-ofK12-DNA DEFINE O157-set AS Genes-ofO157-DNA FOR EACH protein IN O157-set WHEN Constituent-of (K12-set, protein) = FALSE COLLECT protein "Constituent-of"? "Same"? >NC_000913 (size:4639221) AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAA AAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAAT TAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATA GCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCAT TAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG GCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGG CTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCG ATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCT GCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCAT TAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTG CCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCG CAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCT GCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGC TGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTA GAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCT GGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCC GCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCA GGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAA CGGTTCCGACTACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATT GTTGCGAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGT CAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTACCAGGAAGCGAT GGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCC CCATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCT CAAGCACCAGGTACGCTCATTGGTGCCAGCCGTGATGAAGACGAATTACC GGTCAAGGGCATTTCCAATCTGAATAACATGGCAATGTTCAGCGTTTCTG GTCCGGGGATGAAAGGGATGGTCGGCATGGCGGCGCGCGTCTTTGCAGCG ATGTCACGCGCCCGTATTTCCGTGGTGCTGATTACGCAATCATCTTCCGA ATACAGCATCAGTTTCTGCGTTCCACAAAGCGACTGTGTGCGAGCTGAAC GGGCAATGCAGGAAGAGTTCTACCTGGAACTGAAAGAAGGCTTACTGGAG CCGCTGGCAGTGACGGAACGGCTGGCCATTATCTCGGTGGTAGGTGATGG TATGCGCACCTTGCGTGGGATCTCGGCGAAATTCTTTGCCGCACTGGCCC GCGCCAATATCAACATTGTCGCCATTGCTCAGGGATCTTCTGAACGCTCA ATCTCTGTCGTGGTAAATAACGATGATGCGACCACTGGCGTGCGCGTTAC TCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTG GCGTCGGTGGCGTTGGCGGTGCGCTGCTGGAGCAACTGAAGCGTCAGCAA AGCTGGCTGAAGAATAAACATATCGACTTACGTGTCTGCGGTGTTGCCAA CTCGAAGGCTCTGCTCACCAATGTACATGGCCTTAATCTGGAAAACTGGC AGGAAGAACTGGCGCAAGCCAAAGAGCCGTTTAATCTCGGGCGCTTAATT >NC_000913 (size:4639221) AGCTTTTCATTCTGACTGCAACGGGCAAT AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAA AAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAAT TAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATA GCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCAT TAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG GCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGG CTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCG ATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCT GCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCAT TAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTG CCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCG CAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCT GCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGC TGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTA GAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCT GGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCC GCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCA GGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAA CGGTTCCGACTACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATT GTTGCGAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGT CAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTACCAGGAAGCGAT GGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCC CCATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCT CAAGCACCAGGTACGCTCATTGGTGCCAGCCGTGATGAAGACGAATTACC GGTCAAGGGCATTTCCAATCTGAATAACATGGCAATGTTCAGCGTTTCTG GTCCGGGGATGAAAGGGATGGTCGGCATGGCGGCGCGCGTCTTTGCAGCG ATGTCACGCGCCCGTATTTCCGTGGTGCTGATTACGCAATCATCTTCCGA ATACAGCATCAGTTTCTGCGTTCCACAAAGCGACTGTGTGCGAGCTGAAC GGGCAATGCAGGAAGAGTTCTACCTGGAACTGAAAGAAGGCTTACTGGAG CCGCTGGCAGTGACGGAACGGCTGGCCATTATCTCGGTGGTAGGTGATGG TATGCGCACCTTGCGTGGGATCTCGGCGAAATTCTTTGCCGCACTGGCCC GCGCCAATATCAACATTGTCGCCATTGCTCAGGGATCTTCTGAACGCTCA ATCTCTGTCGTGGTAAATAACGATGATGCGACCACTGGCGTGCGCGTTAC TCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTG GCGTCGGTGGCGTTGGCGGTGCGCTGCTGGAGCAACTGAAGCGTCAGCAA AGCTGGCTGAAGAATAAACATATCGACTTACGTGTCTGCGGTGTTGCCAA CTCGAAGGCTCTGCTCACCAATGTACATGGCCTTAATCTGGAAAACTGGC AGGAAGAACTGGCGCAAGCCAAAGAGCCGTTTAATCTCGGGCGCTTAATT ATGTCTCTGTGTGGATTAAAA AAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAAT TAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATA GCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCAT TAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG GCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGG CTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCG ATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCT GCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCAT TAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTG CCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCG CAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCT GCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGC TGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTA GAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCT GGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCC GCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCA GGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAA CGGTTCCGACTACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATT GTTGCGAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGT CAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTACCAGGAAGCGATGGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCC CCATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCT >NC_000913 (size:4639221) AGCTTTTCATTCTGACTGCAACGGGCAAT AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAA AAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAAT TAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATA GCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCAT TAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG GCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGG CTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCG ATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCT GCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCAT TAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTG CCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCG CAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCT GCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGC TGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTA GAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCT GGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCC GCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCA GGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAA CGGTTCCGACTACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATT GTTGCGAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGT CAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTACCAGGAAGCGAT GGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCC CCATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCT CAAGCACCAGGTACGCTCATTGGTGCCAGCCGTGATGAAGACGAATTACC GGTCAAGGGCATTTCCAATCTGAATAACATGGCAATGTTCAGCGTTTCTG GTCCGGGGATGAAAGGGATGGTCGGCATGGCGGCGCGCGTCTTTGCAGCG ATGTCACGCGCCCGTATTTCCGTGGTGCTGATTACGCAATCATCTTCCGA ATACAGCATCAGTTTCTGCGTTCCACAAAGCGACTGTGTGCGAGCTGAAC GGGCAATGCAGGAAGAGTTCTACCTGGAACTGAAAGAAGGCTTACTGGAG CCGCTGGCAGTGACGGAACGGCTGGCCATTATCTCGGTGGTAGGTGATGG TATGCGCACCTTGCGTGGGATCTCGGCGAAATTCTTTGCCGCACTGGCCC GCGCCAATATCAACATTGTCGCCATTGCTCAGGGATCTTCTGAACGCTCA ATCTCTGTCGTGGTAAATAACGATGATGCGACCACTGGCGTGCGCGTTAC TCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTG GCGTCGGTGGCGTTGGCGGTGCGCTGCTGGAGCAACTGAAGCGTCAGCAA AGCTGGCTGAAGAATAAACATATCGACTTACGTGTCTGCGGTGTTGCCAA CTCGAAGGCTCTGCTCACCAATGTACATGGCCTTAATCTGGAAAACTGGC AGGAAGAACTGGCGCAAGCCAAAGAGCCGTTTAATCTCGGGCGCTTAATT ATGTCTCTGTGTGGATTAAAA AAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAAT TAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATA GCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCAT TAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG GCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGG CTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCG ATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCT GCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCAT TAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTG CCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCG CAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCT GCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGC TGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTA GAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCT GGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCC GCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCA GGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAA CGGTTCCGACTACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATT GTTGCGAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGT CAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTACCAGGAAGCGATGGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCC CCATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCT Information AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAA AAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAAT TAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATA GCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCAT TAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG GCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGG CTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCG ATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCT GCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCAT TAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTG CCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCG CAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCT GCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGC TGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTA GAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCT GGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCC GCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCA GGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAA CGGTTCCGACTACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATT GTTGCGAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGT CAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTACCAGGAAGCGAT GGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCC CCATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCT CAAGCACCAGGTACGCTCATTGGTGCCAGCCGTGATGAAGACGAATTACC GGTCAAGGGCATTTCCAATCTGAATAACATGGCAATGTTCAGCGTTTCTG GTCCGGGGATGAAAGGGATGGTCGGCATGGCGGCGCGCGTCTTTGCAGCG ATGTCACGCGCCCGTATTTCCGTGGTGCTGATTACGCAATCATCTTCCGA ATACAGCATCAGTTTCTGCGTTCCACAAAGCGACTGTGTGCGAGCTGAAC GGGCAATGCAGGAAGAGTTCTACCTGGAACTGAAAGAAGGCTTACTGGAG CCGCTGGCAGTGACGGAACGGCTGGCCATTATCTCGGTGGTAGGTGATGG TATGCGCACCTTGCGTGGGATCTCGGCGAAATTCTTTGCCGCACTGGCCC GCGCCAATATCAACATTGTCGCCATTGCTCAGGGATCTTCTGAACGCTCA ATCTCTGTCGTGGTAAATAACGATGATGCGACCACTGGCGTGCGCGTTAC TCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTG GCGTCGGTGGCGTTGGCGGTGCGCTGCTGGAGCAACTGAAGCGTCAGCAA AGCTGGCTGAAGAATAAACATATCGACTTACGTGTCTGCGGTGTTGCCAA CTCGAAGGCTCTGCTCACCAATGTACATGGCCTTAATCTGGAAAACTGGC AGGAAGAACTGGCGCAAGCCAAAGAGCCGTTTAATCTCGGGCGCTTAATT +Self-assembly DNA Protein Structure+Function CGACCATCGCCTTAGTAC Study Question 11 How do genes exert control over cellular processes? Structure AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAA AAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAAT TAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATA GCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCAT TAGCACCACCATTAC
    Related Search
    We Need Your Support
    Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

    Thanks to everyone for your continued support.

    No, Thanks